Stem-loop sequence aly-MIR4230

AccessionMI0015791 (change log)
DescriptionArabidopsis lyrata miR4230 stem-loop
Stem-loop
   --aa            cuc   u     g   a              u     -uau  g 
5'     uuauuauuauac   uca gucuc gaa uuugcacccuguga uaaua    ug a
       ||||||||||||   ||| ||||| ||| |||||||||||||| |||||    ||  
3'     aauaauaaugug   agu cagag uuu aaacgugggacacu guuau    ac a
   auaa            uaa   u     a   c              c     uuuu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 6818689-6818807 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR4230
aly-MIR4230GL348715.1: 6818689-6818807 [-]
aly-MIR4229GL348715.1: 6816117-6816259 [-]
Database links

Mature sequence aly-miR4230

Accession MIMAT0017918
Sequence

21 - 

ugucucggaaauuugcacccu

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1