Stem-loop sequence aly-MIR3444b

AccessionMI0015793 (change log)
DescriptionArabidopsis lyrata miR3444b stem-loop
Gene family MIPF0001177; MIR3444
Stem-loop
   --uugaauccaaauuccaaac                    c      c  ca    aa    aa 
5'                      uauugggagauugaugagau gaccga ac  aauc  gauc  u
                        |||||||||||||||||||| |||||| ||  ||||  ||||   
3'                      auaacccucuaacuacucua cuggcu ug  uuag  uuag  g
   cuuuuaaagccaaauccaagc                    -      u  cc    ca    aa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 2558111-2558239 [-]
intergenic
Database links

Mature sequence aly-miR3444b

Accession MIMAT0017920
Sequence

89 - 

aucucaucaaucucccaauac

 - 109

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1