Stem-loop sequence aly-MIR4232

AccessionMI0015794 (change log)
DescriptionArabidopsis lyrata miR4232 stem-loop
Stem-loop
   ---u        a   aaau   u ug   a     -    c      acuucauucaauaccaagaaaaaggac 
5'     uucauuuu caa    agc a  uau ccugg gggu ugaauc                           c
       |||||||| |||    ||| |  ||| ||||| |||| ||||||                            
3'     gaguaaaa guu    ucg u  gua ggauu uuua acuuag                           g
   gagu        -   acgc   - gu   -     a    c      uuggccaaaccuauugcuauacaauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 23154953-23155097 [+]
intergenic
Database links

Mature sequence aly-miR4232

Accession MIMAT0017921
Sequence

104 - 

ucacauuuauuaggaugugugc

 - 125

Get sequence
Evidence experimental; SOLiD [1]

References

1