Stem-loop sequence aly-MIR4233

AccessionMI0015795 (change log)
DescriptionArabidopsis lyrata miR4233 stem-loop
Stem-loop
   ----        u     au             g      ug          c      auuggauccauggcuauauggauua 
5'     gacaaaug aagau  uuggaguugaugu ggugau  guauguggug ugaaca                         u
       |||||||| |||||  ||||||||||||| ||||||  |||||||||| ||||||                          
3'     cuguuugu uucua  aaccucaacuaca cuacua  cauacacuac auuugu                         u
   uuuc        u     --             a      ca          a      aaugucuaaugugaaauaaugccau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 12714347-12714510 [+]
intergenic
Database links

Mature sequence aly-miR4233

Accession MIMAT0017922
Sequence

124 - 

cacaucaucaacaucaacucc

 - 144

Get sequence
Evidence experimental; SOLiD [1]

References

1