Stem-loop sequence aly-MIR4235

AccessionMI0015797 (change log)
DescriptionArabidopsis lyrata miR4235 stem-loop
Stem-loop
   ---cugu     gugu     cu        u                      ---ag   a a        a 
5'        aguau    gauuu  ggguugua uguuuucaguuccuguucugua     uga u ugaccaau c
          |||||    |||||  |||||||| ||||||||||||||||||||||     ||| | ||||||||  
3'        ucaug    cuaga  cccaacau acaaaagucaaggacaagacau     acu a auugguug u
   ucauuuu     -guu     uc        c                      gucga   c c        u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 17278055-17278197 [+]
intergenic
Database links

Mature sequence aly-miR4235

Accession MIMAT0017924
Sequence

103 - 

acugaaaacacuacaaccccu

 - 123

Get sequence
Evidence experimental; SOLiD [1]

References

1