Stem-loop sequence aly-MIR4238

AccessionMI0015800 (change log)
DescriptionArabidopsis lyrata miR4238 stem-loop
Stem-loop
   ---uuucaa    gau                           -u        aa      c 
5'          gagu   uugguuugggguuuuaauuugcaaaaa  uugaaguc  ugugug u
            ||||   |||||||||||||||||||||||||||  ||||||||  |||||| a
3'          cuua   gaccaaaccccaaaauuaaacguuuuu  aacuucag  auacgc u
   guacuaauc    -au                           uu        aa      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 4417749-4417870 [+]
intergenic
Database links

Mature sequence aly-miR4238

Accession MIMAT0017927
Sequence

81 - 

uuuuugcaaauuaaaaccccaa

 - 102

Get sequence
Evidence experimental; SOLiD [1]

References

1