Stem-loop sequence aly-MIR4242

AccessionMI0015804 (change log)
DescriptionArabidopsis lyrata miR4242 stem-loop
Stem-loop
   ---c    a   uc      u           u            caagcagugucugaugggcugcugauauuuuucucuuccuauuacc 
5'     ccaa ucc  agaacu gggaaugcuau guuaacuuuucu                                              c
       |||| |||  |||||| ||||||||||| ||||||||||||                                              u
3'     gguu agg  ucuuga cccuuacggua caauugaaaaga                                              g
   cgaa    a   -u      u           u            ucucaaagacauuguguguagaaagguuuacguuacguuguaaggu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 19830812-19830992 [+]
intergenic
Database links

Mature sequence aly-miR4242

Accession MIMAT0017931
Sequence

141 - 

aaaguuaacuauggcauuccc

 - 161

Get sequence
Evidence experimental; SOLiD [1]

References

1