Stem-loop sequence aly-MIR4243

AccessionMI0015805 (change log)
DescriptionArabidopsis lyrata miR4243 stem-loop
Gene family MIPF0001170; MIR4243
Stem-loop
   uua        -----     c    g     a                  acaauu      agucucacucucaagauuuugugguuguug 
5'    agaaccau     gauua aguu aaauu uagauuucguacaugaca      ugcucu                              u
      ||||||||     ||||| |||| ||||| ||||||||||||||||||      ||||||                              u
3'    ucuuggua     uuaau ucaa uuuaa aucuaaagcauguacugu      acgaga                              g
   ---        gguaa     c    a     c                  --acgu      guauaaacuguacauaagagagcuuaugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 11472000-11472178 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR4243
aly-MIR4243GL348720.1: 11472000-11472178 [+]
aly-MIR4244GL348720.1: 11474457-11474563 [+]
Database links

Mature sequence aly-miR4243

Accession MIMAT0017932
Sequence

21 - 

ugaaauuauagauuucguaca

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1