Stem-loop sequence aly-MIR4244

AccessionMI0015806 (change log)
DescriptionArabidopsis lyrata miR4244 stem-loop
Stem-loop
   --auuauc       g    c     u     c               gagau 
5'         caaaguu ucgu guugu gauuc uuggagauugaauuu     a
           ||||||| |||| ||||| ||||| |||||||||||||||     u
3'         guuucaa agua caaca cuaag aaccucuagcuuaaa     u
   uacuaguu       a    a     c     a               gcaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 11474457-11474563 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR4244
aly-MIR4243GL348720.1: 11472000-11472178 [+]
aly-MIR4244GL348720.1: 11474457-11474563 [+]
Database links

Mature sequence aly-miR4244

Accession MIMAT0017933
Sequence

21 - 

uuguugauuccuuggagauug

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1