Stem-loop sequence aly-MIR4247

AccessionMI0015809 (change log)
DescriptionArabidopsis lyrata miR4247 stem-loop
Stem-loop
   --       aa    u    u             u            u   u   uuuaugaacauggaa 
5'   aaauuau  uucc ugaa auguauccuaaua uagacccccauu agu uua               u
     |||||||  |||| |||| ||||||||||||| |||||||||||| ||| |||                
3'   uuuaaua  aagg acuu uacauaggauuau aucuggggguaa uca aau               u
   gu       ac    u    u             u            u   u   auaacaaaggaacgu 
Get sequence
Deep sequencing
12 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 21909877-21910016 [-]
intergenic
Database links

Mature sequence aly-miR4247

Accession MIMAT0017936
Sequence

21 - 

uguauccuaauauuagacccc

 - 41

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1