Stem-loop sequence aly-MIR4248a

AccessionMI0015810 (change log)
DescriptionArabidopsis lyrata miR4248a stem-loop
Gene family MIPF0001108; MIR4208
Stem-loop
   -ugug       -u               a                  cuu        ucaaaag            c a     a   uaauauauau 
5'      gugauau  caaaauauacauuuu uuuuuggcaaucauuuuu   uuauaaau       ucauuuuucuuu u aaaac caa          a
        |||||||  ||||||||||||||| ||||||||||||||||||   ||||||||       |||||||||||| | ||||| |||          u
3'      cauuaua  guuuuauauguaaaa aaaaaccguuaguaaaag   aauauuua       aguaaaaagaaa a uuuug guu          a
   aaaaa       uu               g                  ---        -------            a a     a   ugcaaccaau 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 5411335-5411525 [-]
intergenic
Database links

Mature sequence aly-miR4248a

Accession MIMAT0017937
Sequence

21 - 

acauuuuauuuuuggcaauca

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1