Stem-loop sequence ath-MIR4221

AccessionMI0015815 (change log)
DescriptionArabidopsis thaliana miR4221 stem-loop
Gene family MIPF0001128; MIR4221
Stem-loop
   uaguauauccguuucac      u  u  g              u    uu  -u    gccauauuaaguuacaugugg 
5'                  aguuuu cc cu uugaauucuugcac agcu  ca  augg                     g
                    |||||| || || |||||||||||||| ||||  ||  ||||                     u
3'                  ucaaag gg ga aauuugagaacgug ucga  gu  uacc                     g
   ---------------uu      u  u  a              u    uc  cu    aacgacgugacaaugccgugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 8460516-8460662 [+]
intergenic
Database links

Mature sequence ath-miR4221

Accession MIMAT0017942
Sequence

21 - 

uuuuccucuguugaauucuugc

 - 42

Get sequence
Evidence experimental; SOLiD [1]

References

1