Stem-loop sequence ath-MIR4227

AccessionMI0015816 (change log)
DescriptionArabidopsis thaliana miR4227 stem-loop
Gene family MIPF0001115; MIR4227
Stem-loop
   ----     cacgacaa  c       c  g         u         u    acu     u 
5'     guuca        ca aauuuca ug uaccaauca uccaacaaa uaua   cgguc c
       |||||        || ||||||| || ||||||||| ||||||||| ||||   ||||| a
3'     uaagu        gu uuaaagu ac augguuagu agguuguuu auau   guuag g
   uuuu     --uuuuaa  u       -  a         u         u    ---     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22372670-22372790 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR4227
ath-MIR5022chr1: 22372462-22372578 [+]
ath-MIR4227chr1: 22372670-22372790 [+]
Database links

Mature sequence ath-miR4227

Accession MIMAT0017943
Sequence

21 - 

ucacugguaccaaucauucca

 - 41

Get sequence
Evidence experimental; SOLiD [1]

References

1