Stem-loop sequence ath-MIR3440b

AccessionMI0015818 (change log)
DescriptionArabidopsis thaliana miR3440b stem-loop
Gene family MIPF0001127; MIR3440
Stem-loop
   u   --         u        g  uu       c               --        a 
5'  cug  guauuuugc caaguaug uu  cuuggcc auccacuucuaaugu  guuuugua c
    |||  ||||||||| |||||||| ||  ||||||| |||||||||||||||  |||||||| u
3'  gac  cguaaaacg guucaugc aa  gaacugg uaggugaagauuacg  uaaaacgu a
   u   gg         u        g  gg       u               ug        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 6217476-6217600 [+]
intergenic
Database links

Mature sequence ath-miR3440b-5p

Accession MIMAT0017945
Sequence

24 - 

uuuucuuggcccauccacuuc

 - 44

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR3440b-3p

Accession MIMAT0017946
Sequence

84 - 

uggauuggucaagggaagcgu

 - 104

Get sequence
Evidence experimental; SOLiD [1]

References

1
2
PMID:20621980 "siRNAs from miRNA sites mediate DNA methylation of target genes" Chellappan P, Xia J, Zhou X, Gao S, Zhang X, Coutino G, Vazquez F, Zhang W, Jin H Nucleic Acids Res. 38:6883-6894(2010).