Stem-loop sequence ath-MIR4240

AccessionMI0015820 (change log)
DescriptionArabidopsis thaliana miR4240 stem-loop
Gene family MIPF0001198; MIR4240
Stem-loop
   --cu     a c          a   c       a         -      u  c      cau   aa      uuu      ucugaggauuauuuuucaagau 
5'     uucgu g caugaaguua ugg uagagug cuagacccg uaacau ac auauau   uug  cugaaa   guuugu                      a
       ||||| | |||||||||| ||| ||||||| ||||||||| |||||| || ||||||   |||  ||||||   ||||||                       
3'     gagca c guacuuuagu acc aucucac gaucugggc auugua ug uauaua   agc  gauuuu   caaaca                      u
   cucc     c a          c   u       -         u      u  c      ---   --      uuu      cgucggugaauagaagcaaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 10711558-10711762 [-]
intergenic
Database links

Mature sequence ath-miR4240

Accession MIMAT0017948
Sequence

31 - 

ugacuagacccguaacauuac

 - 51

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
2
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).