Stem-loop sequence ame-mir-3751

AccessionMI0016151 (change log)
DescriptionApis mellifera miR-3751 stem-loop
Stem-loop
   aa g   g    gua  ga     ca    a   ggugg      ga   uuuc a      -  au     a ac 
5'   u uuu ucgc   uu  ccggc  ucca cgc     cacccc  gaa    g aaacug ca  ugcau g  a
     | ||| ||||   ||  |||||  |||| |||     ||||||  |||    | |||||| ||  ||||| |   
3'   a gaa agug   gg  ggcug  aggu gug     gugggg  cuu    c uuuggc gu  acgua c  g
   -g g   a    --a  gg     -a    g   -----      -g   ---- a      a  --     g ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 8355801-8355937 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3751
ame-mir-3752CM000062.5: 8352494-8352601 [-]
ame-mir-3751CM000062.5: 8355801-8355937 [+]
Database links

Mature sequence ame-miR-3751-3p

Accession MIMAT0018521
Sequence

103 - 

ggguggugguggaagucgggg

 - 123

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).