Stem-loop sequence ame-mir-3792

AccessionMI0016205 (change log)
DescriptionApis mellifera miR-3792 stem-loop
Stem-loop
   c    ucuc  c    uuac    auuc    -  --g     ag   ---a  -     -   --    aaa    
5'  ggcc    gu cgag    gugu    cgug ga   gacug  gaa    ga gagaa gga  ucgg   cgc 
    ||||    || ||||    ||||    |||| ||   |||||  |||    || ||||| |||  ||||   || a
3'  ccgg    ca gcuu    uaca    gcgc cu   uugac  cuu    cu cuuuu ccu  ggcc   gca 
   u    --uu  a    ----    gcua    u  auu     aa   guag  a     g   ua    aac    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 10468168-10468304 [+]
intergenic
Database links

Mature sequence ame-miR-3792-5p

Accession MIMAT0018575
Sequence

36 - 

gacugaggaaagagagaagga

 - 56

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).