Stem-loop sequence ame-mir-3728

AccessionMI0016225 (change log)
DescriptionApis mellifera miR-3728 stem-loop
Stem-loop
   gagc    g   cuauua  ---a    uaaccau       au     a    g    ua    a 
5'     gcgc ugu      gu    gcgg       ccguggg  ucgua uuua uuuc  guuu u
       |||| |||      ||    ||||       |||||||  ||||| |||| ||||  |||| c
3'     ugcg aca      cg    cgcc       ggcgcuu  agcau ggau gaag  uagg u
   ---a    g   uaaaug  gaag    -------       --     a    g    -c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000060.5: 12048501-12048619 [+]
intergenic
Database links

Mature sequence ame-miR-3728-5p

Accession MIMAT0018595
Sequence

29 - 

ccauccgugggauucguaauuua

 - 51

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).