Stem-loop sequence ame-mir-3739

AccessionMI0016238 (change log)
DescriptionApis mellifera miR-3739 stem-loop
Stem-loop
   ----------c    aauc  c  - ga      g     c    a  aau      cu 
5'            uucu    gc gc c  uccucc cccga gagg uc   uucuau  c
              ||||    || || |  |||||| ||||| |||| ||   ||||||  u
3'            aaga    cg cg g  aggggg ggguu uuuc ag   gaggug  a
   uaauaagcuca    ccgu  a  a ag      a     u    a  --g      cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000056.5: 14316213-14316320 [-]
intergenic
Database links

Mature sequence ame-miR-3739-3p

Accession MIMAT0018608
Sequence

69 - 

uugggagggggagagagcagcu

 - 90

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).