Stem-loop sequence hvu-MIR159a

AccessionMI0016452 (change log)
DescriptionHordeum vulgare miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

13 open access papers mention hvu-MIR159a
(78 sentences)

Stem-loop
   g ug        a   u     uga  -    uac  ga    u   -u  a   g    u     guuc    uau         auuag 
5'  g  gagcuccu uca uccaa   ag gguc   cg  aggg uug  gc gcu cuug ucaug    ccac   ccuaucucc     a
    |  |||||||| ||| |||||   || ||||   ||  |||| |||  || ||| |||| |||||    ||||   |||||||||      
3'  c  cucgaggg agu agguu   uc ccag   gc  uccc agc  cg cga gagc aguac    ggug   ggauagagg     a
   a gu        a   u     -ug  g    -uc  --    u   uu  c   g    u     guuu    uuc         agcac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Hvul_cvHarunaNijo3HBAC01; GCA_000227425.1) Overlapping transcripts
BACC01000259.1: 1889-2066 [+]
intergenic
Database links

Mature sequence hvu-miR159a

Accession MIMAT0018210
Sequence

156 - 

uuuggauugaagggagcucug

 - 176

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
3
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).