Stem-loop sequence tae-MIR395b

AccessionMI0016464 (change log)
DescriptionTriticum aestivum miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

12 open access papers mention tae-MIR395b
(28 sentences)

Stem-loop
   cu          -         u     uc              aga      cca   a  au 
5'   gaaguguuug ggggaacuc uggug  accaagcauuuagu   cauugg   cau uc  a
     |||||||||| ||||||||| |||||  ||||||||||||||   ||||||   ||| ||   
3'   cuucacgaac uuccuuggg accau  ugguuuguaagucg   guaacu   gua ag  a
   --          g         u     uc              --g      -ac   g  ag 
Get sequence
Deep sequencing
19611 reads, 15.5 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR395b

Accession MIMAT0018223
Sequence

2 - 

ugaaguguuugggggaacuc

 - 21

Get sequence
Deep sequencing15736 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).