![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR156f |
|||||
Accession | MI0016559 (change log) | ||||
Description | Glycine max miR156f stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
40 open access papers mention gma-MIR156f | ||||
Stem-loop |
-auaucuc u -a -a g u u g 5' aug ugacaga gagagagagcaca cccgg aa ggu aaag a ||| ||||||| ||||||||||||| ||||| || ||| |||| 3' uac acugucu uucucucucgugu ggguu uu ccg uuuc g acuuacac u cc ga g u - u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR156f |
|
Accession | MIMAT0018318 |
Sequence |
11 - uugacagaagagagagagcaca - 32 |
Evidence | experimental; Illumina [1-3] |
References |
|
1 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
3 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|