Stem-loop sequence gma-MIR156f

AccessionMI0016559 (change log)
DescriptionGlycine max miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156f
(171 sentences)

Stem-loop 
   -auaucuc   u       -a             -a     g  u   u    g 
5'         aug ugacaga  gagagagagcaca  cccgg aa ggu aaag a
           ||| |||||||  |||||||||||||  ||||| || ||| ||||  
3'         uac acugucu  uucucucucgugu  ggguu uu ccg uuuc g
   acuuacac   u       cc             ga     g  u   -    u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 47699715-47699820 [-]
intergenic
Database links

Mature sequence gma-miR156f

Accession MIMAT0018318
Sequence

11 -  

uugacagaagagagagagcaca

 - 32

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).