Stem-loop sequence gma-MIR1520q

AccessionMI0016573 (change log)
DescriptionGlycine max miR1520q stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520q
(2 sentences)

Stem-loop 
   ugg     c        a       aa               ug    g   a  cc 
5'    uguca gugucaug ucugauu  uuaauaaaaauaaca  acau uca cu  a
      ||||| |||||||| |||||||  |||||||||||||||  |||| ||| ||  u
3'    acagu cacaguac agacuaa  aguuauuuuuguugu  ugua agu ga  a
   -ua     a        a       cc               ua    a   a  aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 13091468-13091583 [-]
intergenic
Database links

Mature sequence gma-miR1520q

Accession MIMAT0018332
Sequence

86 -  

auugaccaaucagaacaugacaca

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).