Stem-loop sequence hvu-MIR1120

AccessionMI0016741 (change log)
DescriptionHordeum vulgare miR1120 stem-loop
Gene family MIPF0000443; MIR1120
Literature search

5 open access papers mention hvu-MIR1120
(24 sentences)

Stem-loop
   cu     c   u       -               a        
5'   acucc ucc ucccaua uauaagaguguuuuu auacuac 
     ||||| ||| ||||||| ||||||||||||||| |||||| a
3'   ugagg agg aggguau auauucuuacaaaaa ugugauc 
   -u     -   c       u               g        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR1120

Accession MIMAT0018499
Sequence

56 - 

acauucuuauauuaugggacggag

 - 79

Get sequence
Evidence not experimental

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
2
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).