Stem-loop sequence hvu-MIR444a

AccessionMI0016745 (change log)
Previous IDshvu-MIR444
DescriptionHordeum vulgare miR444a stem-loop
Gene family MIPF0000402; MIR444
Literature search

7 open access papers mention hvu-MIR444a
(18 sentences)

Stem-loop
        -     ---   a  c    ---  u  c      c   a     aauuaauaga 
5' aggca caagu   agg ca caac   au ac ugcaag aag cgcaa          a
   ||||| |||||   ||| || ||||   || || |||||| ||| |||||           
3' uccgu guucg   ucc gu guug   ug ug acguuc uuc guguu          c
        c     aac   -  c    acg  c  a      u   g     cauaccacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR444a

Accession MIMAT0018503
Previous IDshvu-miR444
Sequence

92 - 

uugcugccucaagcuugcugc

 - 112

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
2
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).