![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4454 |
|||||
Accession | MI0016800 (change log) | ||||
Symbol | HGNC:MIR4454 | ||||
Description | Homo sapiens miR-4454 stem-loop | ||||
Literature search |
![]()
7 open access papers mention hsa-mir-4454 | ||||
Stem-loop |
--cc a - gagu - - aa 5' gg uc c cacgg cac ca u || || | ||||| ||| || u 3' cc ag g gugcc gug gu u acca - a aagu u c ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4454 |
|
Accession | MIMAT0018976 |
Sequence |
3 - ggauccgagucacggcacca - 22 |
Deep sequencing | 294089 reads, 158 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|