Stem-loop hsa-mir-4454

Accession

MI0016800

Symbol

HGNC: MIR4454

Description

Homo sapiens hsa-mir-4454 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4454 is a microRNA that has been found to be overexpressed in ameloblastomas, a type of tumor, in several studies [PMC7920560] [PMC5354851]. Artificial induction of MIR4454 expression has been shown to reduce tumor tissue and increase sensitivity to certain drugs, such as 5FU, CPT11, and oxaliplatin [PMC7602903]. The drug transporter MRP5 has been found to decrease sensitivity to oxaliplatin by increasing drug efflux and reducing intracellular oxaliplatin accumulation [PMC7602903]. Downregulation of MIR4454 has been associated with drug resistance in colorectal cancer [PMC7602903]. Additionally, it has been observed that some reads of hsa-miR-4454 display heterogenous 5' ends that differ from the annotated genomic locus sequence but match the sequence of tRNAHis [PMC6675128]. The expression profile of three miRNAs related to hepatocellular carcinoma (HCC), including MIR4454, was assessed using RT-qPCR at different time points in order to determine the effect of different combinations of reference genes on normalization [PMC7035418]. Overall, these studies highlight the potential role and significance of MIR4454 in tumor development and drug response.

Literature search

7 open access papers mention hsa-mir-4454
(21 sentences)

Sequence

25232 reads, 349 reads per million, 126 experiments

ccGGAUCCGAGUCACGGCACCAaauuucaugcguguccgugugaagagaccacca
..((.(((....((((((((((.......)).))).)))))....).))))....

Structure

--cc  A  - GAGU     -   -  aa 
    GG UC C    CACGG CAC CA  u
    || || |    ||||| ||| ||  u
    cc ag g    gugcc gug gu  u
acca  -  a aagu     u   c  ac 

Annotation confidence Not enough data

Genome context

chr4: 163093574-163093628 [-]

Disease association

hsa-mir-4454 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4454

• Accession: MIMAT0018976
• Description: Homo sapiens hsa-miR-4454 mature miRNA
• Sequence: 3 - GGAUCCGAGUCACGGCACCA - 22
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127