Stem-loop hsa-mir-4484

Accession

MI0016845

Symbol

HGNC: MIR4484

Description

Homo sapiens hsa-mir-4484 precursor miRNA

Gene family

MIPF0001440; mir-4484

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4484 is an RNA gene located at chromosome 10 in locus q26.2. It has been shown to act as a tumor suppressor [PMC6776520]. Copy number analysis of the MIR4484 locus was performed using SYBR green-based quantitative PCR with DNA-specific primers [PMC5537698]. The genomic levels of the region encompassing the MIR4484 precursor sequence were assayed, and it was found that the MIR4484 locus undergoes copy number loss [PMC5537698]. The C t values of MIR4484 were normalized with the C t value of GAPDH to obtain ΔC t, and the final copy number was deduced using the ΔΔC t method [PMC5537698]. The deletion at the UROS locus, which is closely located to MIR4484, affected both UROS and MIR4484 genes but did not affect nearby genes such as BRCA2 and CDKN1A interacting protein (BCCIP) and matrix metallopeptidase 21 (MMP21) [PMC5537698]. The correlation between deletion patterns in UROS and MIR4484 was observed through DNA qPCR analysis in a similar set of samples [PMC5537698]. It is worth noting that metalloproteinases, such as matrix metalloproteinase 21 (MMP-21), which is closely located to MIR4484, are known to be involved in fibrotic processes in systemic sclerosis (SSc) [PMC6776520].

Literature search

8 open access papers mention hsa-mir-4484
(14 sentences)

Sequence

2021 reads, 182 reads per million, 86 experiments

ggguuuccucugccuuuuuuuccaaugaaaauaacgaaaccuguuauuucccauugagggggaAAAAGGCGGGAGAAGCCCCA
(((((((.(((((((((((((((((((.((((((((.....))))))))..))))...))))))))))))))).)))))))..

Structure

--       c               ---    -a        a 
  ggguuuc ucugccuuuuuuucc   aaug  aaauaacg a
  ||||||| |||||||||||||||   ||||  |||||||| a
  CCCGAAG GGGCGGAAAAagggg   uuac  uuuauugu c
AC       A               gag    cc        c 

Annotation confidence Not enough data

Genome context

chr10: 125819740-125819822 [+]

Disease association

hsa-mir-4484 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4484

• Accession: MIMAT0019018
• Description: Homo sapiens hsa-miR-4484 mature miRNA
• Sequence: 64 - AAAAGGCGGGAGAAGCCCCA - 83
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127