WARNING: This summary was generated by AI. MIR4484 is identified as an RNA gene located on chromosome 10 at the q26.2 locus, which is suggested to function as a tumor suppressor [PMC6776520]. Research has shown that the MIR4484 locus is subject to copy number loss, as demonstrated by quantitative PCR assays targeting the genomic region that includes the miRNA precursor sequence [PMC5537698]. The copy number determination for MIR4484, alongside UROS, was normalized against GAPDH using the ΔΔCt method to ensure accurate quantification [PMC5537698]. The study also included an analysis of genes adjacent to UROS, such as BCCIP and MMP21, to assess if deletions at the UROS locus also affected these neighboring genes [PMC5537698]. However, particular attention was given to MMP21 due to its proximity to MIR4484 and its known involvement in fibrotic processes in systemic sclerosis (SSc), which could suggest a functional relationship between MMP21 and MIR4484 [PMC6776520]. The deletion patterns of MIR4484 were correlated with those of UROS by using a consistent sample set for DNA qPCR analysis [PMC5537698], indicating that changes in genomic content could be systematically evaluated for these genes.
-- c --- -a a ggguuuc ucugccuuuuuuucc aaug aaauaacg a ||||||| ||||||||||||||| |||| |||||||| a CCCGAAG GGGCGGAAAAagggg uuac uuuauugu c AC A gag cc c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0019018 |
| Description | Homo sapiens hsa-miR-4484 mature miRNA |
| Sequence | 64 - AAAAGGCGGGAGAAGCCCCA - 83 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|