Stem-loop hsa-mir-4485

Accession

MI0016846

Symbol

HGNC: MIR4485

Description

Homo sapiens hsa-mir-4485 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4485 is a microRNA that is involved in the maturation process mediated by DGCR8 processing and recognition by METTL3 [PMC8426370]. METTL3 has been shown to promote the maturation of various miRNAs, including let-7e, miR221/222, MIR4485, miR25, miR93, miR126, and miR335 [PMC6588935]. Knockdown of METTL3 in T24 cells resulted in altered expression of several miRNAs, including let-7e, miR221/222, MIR4485, miR25, and miR93 [PMC6588935]. Additionally, METTL3 has been found to affect the internal m6A modification of lincRNA1281 and regulate mouse embryonic stem cell differentiation through a competing endogenous RNA (ceRNA) model [PMC6588935]. Previous studies have also identified MIR4485 as one of the main microRNAs modulated by METTL3 [PMC6588935]. The altered expression of MIR4485 and other microRNAs by METTL3 in T24 cells has been validated [PMC6588935]. In summary, MIR4485 is a microRNA that is involved in the maturation process mediated by DGCR8 processing and recognition by METTL3. Knockdown of METTL3 leads to altered expression of several microRNAs including MIR4485. Additionally,METTL3 affects m6A modification and regulates mouse embryonic stem cell differentiation through a ceRNA model. Previous studies have also identified MIR448 as one of the main microRNAs modulated by METTL3. The altered expression of MIR448 and other microRNAs has been validated in T24 cells.

Literature search

6 open access papers mention hsa-mir-4485
(13 sentences)

Sequence

3214 reads, 314 reads per million, 100 experiments

agaggcACCGCCUGCCCAGUGAcaugcguuUAACGGCCGCGGUACCCUAAcugugca
((.((.(((((..(((....(((....)))....))).))))).)))).........

Structure

---------  a  c     CU   CAGU   a 
         ag gg ACCGC  GCC    GAc u
         || || |||||  |||    |||  
         UC CC UGGCG  CGG    uug g
acgugucAA  -  A     -C   CAAU   c 

Annotation confidence Low

Genome context

chr11: 10508270-10508326 [-]

Disease association

hsa-mir-4485 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4485-3p

• Accession: MIMAT0019019
• Description: Homo sapiens hsa-miR-4485-3p mature miRNA
• Sequence: 31 - UAACGGCCGCGGUACCCUAA - 50
• Evidence: experimental ; Illumina [1]

Mature hsa-miR-4485-5p

• Accession: MIMAT0032116
• Description: Homo sapiens hsa-miR-4485-5p mature miRNA
• Sequence: 7 - ACCGCCUGCCCAGUGA - 22
• Evidence: not_experimental

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127