![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4502 |
|||||
Accession | MI0016865 (change log) | ||||
Symbol | HGNC:MIR4502 | ||||
Description | Homo sapiens miR-4502 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4502 | ||||
Stem-loop |
a -a ug a -uuuu g g gu 5' gccuuuagca gu u auc u cu auggagg c |||||||||| || | ||| | || ||||||| 3' cggaagucgu ua a uag a gg uaccucc u - gg gu g ucggu g g gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4502 |
|
Accession | MIMAT0019038 |
Sequence |
58 - gcugaugaugauggugcugaag - 79 |
Deep sequencing | 242 reads, 28 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|