Stem-loop sequence hsa-mir-4502

AccessionMI0016865 (change log)
Symbol HGNC:MIR4502
DescriptionHomo sapiens miR-4502 stem-loop
Literature search

1 open access papers mention hsa-mir-4502
(1 sentences)

Stem-loop 
   a          -a  ug a   -uuuu g  g       gu 
5'  gccuuuagca  gu  u auc     u cu auggagg  c
    ||||||||||  ||  | |||     | || |||||||   
3'  cggaagucgu  ua  a uag     a gg uaccucc  u
   -          gg  gu g   ucggu g  g       gu
Get sequence
Deep sequencing
262 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 114273828-114273908 [+]
sense
OTTHUMT00000045918 ; TFDP1-001; intron 3
OTTHUMT00000045920 ; TFDP1-003; intron 3
OTTHUMT00000045922 ; TFDP1-005; intron 3
OTTHUMT00000045923 ; TFDP1-006; intron 3
OTTHUMT00000045919 ; TFDP1-002; intron 4
ENST00000375370 ; TFDP1-001; intron 3
ENST00000465174 ; TFDP1-003; intron 3
ENST00000408980 ; TFDP1-005; intron 3
ENST00000453989 ; TFDP1-006; intron 3
ENST00000538138 ; TFDP1-201; intron 3
ENST00000544902 ; TFDP1-202; intron 3
ENST00000475254 ; TFDP1-002; intron 4
Database links

Mature sequence hsa-miR-4502

Accession MIMAT0019038
Sequence

58 -  

gcugaugaugauggugcugaag

 - 79

Get sequence
Deep sequencing242 reads, 28 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).