Stem-loop sequence gma-MIR862a

AccessionMI0017853 (change log)
DescriptionGlycine max miR862a stem-loop
Gene family MIPF0001295; MIR862_2
Literature search

4 open access papers mention gma-MIR862a
(6 sentences)

Stem-loop 
     uc    u     c        u           uu  uaccu 
5' ag  uucg guucc ucaaaggc uccaguauuca  ca     a
   ||  |||| ||||| |||||||| |||||||||||  ||      
3' uc  aagu uaagg aguuucug aggucguaagu  gu     a
     ga    u     a        u           uc  ugauc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 57326469-57326558 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR862a
gma-MIR5037bchr18: 57328532-57328634 [+]
gma-MIR862achr18: 57326469-57326558 [-]
Database links

Mature sequence gma-miR862a

Accession MIMAT0021004
Sequence

60 -  

ugcuggaugucuuugaaggaau

 - 81

Get sequence
Evidence experimental; 454 [1], SOLiD [2], Illumina [3-4]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).