Stem-loop gma-MIR862a

Accession

MI0017853

Description

Glycine max gma-MIR862a precursor miRNA

Gene family

MIPF0001295; MIR862_2

Literature search

4 open access papers mention gma-MIR862a
(6 sentences)

Sequence

agucuucguguucccucaaaggcuuccaguauucauucauaccuaacuaguugcuugaaUGCUGGAUGUCUUUGAAGGAAUuugaaagcu
(((.((((.(((((.((((((((.(((((((((((..((............))..))))))))))).)))))))).))))).)))).)))

Structure

   c    u     c        u           uu  uaccu 
agu uucg guucc ucaaaggc uccaguauuca  ca     a
||| |||| ||||| |||||||| |||||||||||  ||      
ucg aagu UAAGG AGUUUCUG AGGUCGUaagu  gu     a
   a    u     A        U           uc  ugauc 

Annotation confidence Not enough data

Genome context

chr18: 57326469-57326558 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR862a

Mature gma-miR862a

• Accession: MIMAT0021004
• Description: Glycine max gma-miR862a mature miRNA
• Sequence: 60 - UGCUGGAUGUCUUUGAAGGAAU - 81
• Evidence: experimental ; 454 [1], SOLiD [2], Illumina [3-4]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


3. PubMed ID: 21751852
   Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome
   "Radwan O, Liu Y, Clough SJ"
   "Mol Plant Microbe Interact (2011) 24:958-972


4. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153