![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR862a |
||||||
Accession | MI0017853 (change log) | |||||
Description | Glycine max miR862a stem-loop | |||||
Gene family | MIPF0001295; MIR862_2 | |||||
Literature search |
4 open access papers mention gma-MIR862a | |||||
Stem-loop |
uc u c u uu uaccu 5' ag uucg guucc ucaaaggc uccaguauuca ca a || |||| ||||| |||||||| ||||||||||| || 3' uc aagu uaagg aguuucug aggucguaagu gu a ga u a u uc ugauc |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gma-miR862a |
|
Accession | MIMAT0021004 |
Sequence |
60 - ugcuggaugucuuugaaggaau - 81 |
Evidence | experimental; 454 [1], SOLiD [2], Illumina [3-4] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
4 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|