Stem-loop sequence hvu-MIR444b

AccessionMI0017934 (change log)
DescriptionHordeum vulgare miR444b stem-loop
Gene family MIPF0000402; MIR444
Literature search

6 open access papers mention hvu-MIR444b
(15 sentences)

Stem-loop
     u g  c     a       a         u    u            aaaauc     g 
5' gg g ca caagc ugaggca caacugcau acuu caaggaaguuac      uaugg u
   || | || ||||| ||||||| ||||||||| |||| ||||||||||||      |||||  
3' cc c gu guucg acucugu guugacgug ugaa guucuuucagug      auacu c
     u a  c     a       c         u    c            ---cua     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR444b

Accession MIMAT0020543
Sequence

92 - 

ugcaguugcugucucaagcuu

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).