Stem-loop sequence tae-MIR5086

Accession

MI0017949 (change log)

Description

Triticum aestivum miR5086 stem-loop

Literature search

1 open access papers mention tae-MIR5086
(1 sentences)

Stem-loop

   a a a                  g    -gu       c        u     g        acu 
5'  c c aaaucacauugguggaag cgug   aaagaaa aaaaucga gcuuc aaaauguu   u
    | | |||||||||||||||||| ||||   ||||||| |||||||| ||||| ||||||||   a
3'  g g uuuaguguaaccaccuuc gcac   uuuuuuu uuuuagcu ugagg uuuuacga   c
   c c c                  a    guu       u        u     -        aaa 

Deep sequencing

793 reads, 0 reads per million, 115 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context

• Coordinates: 1D: 106288641-106288771 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017949

Mature sequence tae-miR5086

• Accession: MIMAT0020558
• Sequence: 11 - acauugguggaaggcguggua - 31
• Deep sequencing: 473 reads, 114 experiments
• Evidence: not experimental

References

1. PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).