Stem-loop sequence tae-MIR5085

AccessionMI0017958 (change log)
DescriptionTriticum aestivum miR5085 stem-loop
Literature search

2 open access papers mention tae-MIR5085
(19 sentences)

Stem-loop
   uaaa       a       u        c          agacaauuuucgacgcuuaauuac 
5'     gugaaaa ggacauu uuuguggc uguguaaaaa                        a
       ||||||| ||||||| |||||||| ||||||||||                         
3'     cacuuuu ccuguaa aaacaccg acauauuuuu                        a
   aagc       c       c        u          cuauuuuuuuacggagcacuuauc 
Get sequence
Deep sequencing
306 reads, 0 reads per million, 105 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates Overlapping transcripts
7B: 228951380-228951507 [+]
intergenic
Database links

Mature sequence tae-miR5085

Accession MIMAT0020567
Sequence

11 - 

aaggacauuuuuuguggccug

 - 31

Get sequence
Deep sequencing27 reads, 22 experiments
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).