Stem-loop sequence bdi-MIR5070

AccessionMI0017975 (change log)
DescriptionBrachypodium distachyon miR5070 stem-loop
Gene family MIPF0002013; MIR5070
Literature search

1 open access papers mention bdi-MIR5070
(12 sentences)

Stem-loop
   u          g        a             c           aaa        ugac 
5'  ccucagggua ccuuugac cugcuuaguucaa caaaugaacua   uuuuaaaa    a
    |||||||||| |||||||| ||||||||||||| |||||||||||   ||||||||     
3'  ggagucccau ggagacug gaugaaucaaguu guuuacuugau   aagguuuu    c
   g          g        g             u           caa        ucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 35045123-35045246 [+]
intergenic
Database links

Mature sequence bdi-miR5070

Accession MIMAT0020584
Sequence

94 - 

aacuaaguagggucagagggu

 - 114

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).