Stem-loop sequence mmu-mir-5129

AccessionMI0018041 (change log)
Symbol MGI:Mir5129
DescriptionMus musculus miR-5129 stem-loop
Literature search

1 open access papers mention mmu-mir-5129
(2 sentences)

Stem-loop
   u    ugaaua       ------    u     u       c 
5'  cacc      ugugggg      gcau gguau uucaaag a
    ||||      |||||||      |||| ||||| ||||||| g
3'  gugg      acacccu      cgug ccgug aaguuuu c
   -    ----ug       ucucua    u     u       a 
Get sequence
Deep sequencing
585 reads, 0 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 45023100-45023177 [-]
sense
OTTMUST00000107182 ; Zeb2-013; 5'UTR (exon 1)
OTTMUST00000107183 ; Zeb2-007; exon 2
OTTMUST00000029411 ; Zeb2-002; exon 3
OTTMUST00000107184 ; Zeb2-011; exon 3
OTTMUST00000029417 ; Zeb2-008; exon 3
OTTMUST00000029414 ; Zeb2-005; exon 3
OTTMUST00000029410 ; Zeb2-001; exon 4
OTTMUST00000029413 ; Zeb2-004; exon 4
ENSMUST00000176732 ; Zeb2-013; 5'UTR (exon 1)
ENSMUST00000177302 ; Zeb2-007; exon 2
ENSMUST00000028229 ; Zeb2-002; exon 3
ENSMUST00000076836 ; Zeb2-011; exon 3
ENSMUST00000131635 ; Zeb2-008; exon 3
ENSMUST00000127520 ; Zeb2-005; exon 3
ENSMUST00000068415 ; Zeb2-201; exon 3
ENSMUST00000176438 ; Zeb2-001; exon 4
ENSMUST00000145529 ; Zeb2-004; exon 4
Database links

Mature sequence mmu-miR-5129-5p

Accession MIMAT0020640
Previous IDsmmu-miR-5129
Sequence

11 - 

augugggggcauugguauuuuc

 - 32

Get sequence
Deep sequencing479 reads, 58 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-5129-3p

Accession MIMAT0022987
Sequence

47 - 

aaugugccugugcaucucuucc

 - 68

Get sequence
Deep sequencing104 reads, 28 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).