Stem-loop sequence bdi-MIR394

AccessionMI0018115 (change log)
DescriptionBrachypodium distachyon miR394 stem-loop
Gene family MIPF0000100; MIR394
Literature search

1 open access papers mention bdi-MIR394
(1 sentences)

Stem-loop
   ----gcaguaguaaua             gc        c      cg g      -      u c           -------       u    -   g     u 
5'                 gucauguggguuu  caaagggg gcuuac  a agcucu uuggca u uguccaccucc       uugcgag cucg cgg agauc c
                   |||||||||||||  |||||||| ||||||  | |||||| |||||| | |||||||||||       ||||||| |||| ||| |||||  
3'                 cgguauacccaaa  guuucccu cggaug  u ucgagg aaccgu a acggguggagg       gacguuc gagu guu ucuag a
   ucgaccaaacuagaag             au        u      -- g      u      c u           uucgaua       -    u   g     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 52316372-52316571 [-]
intergenic
Database links

Mature sequence bdi-miR394

Accession MIMAT0020690
Sequence

53 - 

uuggcauucuguccaccucc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).