Stem-loop sequence bdi-MIR393a

AccessionMI0018119 (change log)
DescriptionBrachypodium distachyon miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

2 open access papers mention bdi-MIR393a
(5 sentences)

Stem-loop
   ugaga  gag  ggcaac    u  u        a                u     uucgacuccauuaaugguguucg 
5'      gc   ag      aaug cu ggggaagc uccaaagggaucgcau gaucc                       u
        ||   ||      |||| || |||||||| |||||||||||||||| |||||                        
3'      cg   uc      uuac ga cuccuucg agguuuuccuagcgua cuagg                       c
   -cuua  -aa  acauca    c  u        g                -     cagcagcuguuagucgucugcua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 2001005-2001163 [-]
intergenic
Database links

Mature sequence bdi-miR393a

Accession MIMAT0020694
Sequence

36 - 

uccaaagggaucgcauugauc

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).