Stem-loop sequence bdi-MIR5176

AccessionMI0018145 (change log)
DescriptionBrachypodium distachyon miR5176 stem-loop
Stem-loop
   -aguuuauucucuuuucacacguucucucauu                                    auauu 
5'                                 uauucuaugccaugucgucacauauccuacauggca     u
                                   ||||||||||||||||||||||||||||||||||||     a
3'                                 guaagauacgguguaguaguguauaggauguaucgu     c
   acaacguguauguucaaacgagagagaggagc                                    acaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 28306160-28306307 [-]
intergenic
Database links

Mature sequence bdi-miR5176-5p

Accession MIMAT0020720
Sequence

37 - 

uaugccaugucgucacauauc

 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5176-3p

Accession MIMAT0020721
Sequence

95 - 

ugugaugauguggcauagaau

 - 115

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).