Stem-loop sequence bdi-MIR164f

AccessionMI0018216 (change log)
DescriptionBrachypodium distachyon miR164f stem-loop
Gene family MIPF0000045; MIR164
Literature search

3 open access papers mention bdi-MIR164f
(17 sentences)

Stem-loop
            u    c          a       a     g acacacacgcgcauggccggccgcucgggcgacacgcg 
5' aggcgaggc ugcg gguggagaag agggcac ugcau c                                      c
   ||||||||| |||| |||||||||| ||||||| ||||| |                                      g
3' uccgcuccg gcgc ccaccucuuc ucccgug acgua g                                      c
            c    u          g       c     a caaggucgagcggcggccacacggcgcggcgccggacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 19949341-19949501 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR164f
bdi-MIR164a2: 19949322-19949514 [-]
bdi-MIR164f2: 19949341-19949501 [+]
Database links

Mature sequence bdi-miR164f

Accession MIMAT0020741
Sequence

18 - 

uggagaagaagggcacaugca

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1