Stem-loop gma-MIR5037c

Accession

MI0018625

Description

Glycine max gma-MIR5037c precursor miRNA

Gene family

MIPF0001288; MIR5037

Literature search

2 open access papers mention gma-MIR5037c
(2 sentences)

Sequence

cuuuagcaacccucaaaggcuuccacuacuccauauuucagucuagugaauguccacaaacauggaggaguAGUGGAACUUUGAGGCCUGCugaag
((((((((..((((((((..((((((((((((....((((......))))..((((......))))))))))))))))))))))))..))))))))

Structure

        ac        gc            ------------auau    gu 
cuuuagca  ccucaaag  uuccacuacucc                uuca  c
||||||||  ||||||||  ||||||||||||                ||||   
gaaguCGU  GGAGUUUC  AAGGUGAugagg                aagu  u
        CC        --            agguacaaacaccugu    ga 

Annotation confidence Not enough data

Genome context

chr8: 47698518-47698613 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR5037c

Mature gma-miR5037c

• Accession: MIMAT0021606
• Description: Glycine max gma-miR5037c mature miRNA
• Sequence: 72 - AGUGGAACUUUGAGGCCUGC - 91
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553