Stem-loop sequence gma-MIR5373

AccessionMI0018629 (change log)
DescriptionGlycine max miR5373 stem-loop
Literature search

1 open access papers mention gma-MIR5373
(1 sentences)

Stem-loop 
      -  ga      gc   c     ag 
5' uca ua  gucuag  uca gggaa  a
   ||| ||  ||||||  ||| |||||   
3' agu gu  uagauc  agu cucuu  a
      u  ag      uu   u     ag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 28005409-28005463 [+]
intergenic
Database links

Mature sequence gma-miR5373

Accession MIMAT0021611
Sequence

32 -  

ucucuugauucuagaugaugu

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).