Stem-loop sequence gma-MIR408b

AccessionMI0018648 (change log)
DescriptionGlycine max miR408b stem-loop
Gene family MIPF0000102; MIR408
Literature search

16 open access papers mention gma-MIR408b
(54 sentences)

Stem-loop 
       a  g u     c      g   c  a  g     u       aaaugguaaagugagaaug 
5' gaca ag c gggaa aggcag gca ga ug agcua caacaga                   a
   |||| || | ||||| |||||| ||| || || ||||| |||||||                   a
3' cugu uc g cccuu uccguc cgu cu gc ucggu guugucu                   a
       c  g u     c      a   a  c  a     -       agagagagagagagagagg
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 42619826-42619957 [-]
intergenic
Database links

Mature sequence gma-miR408b-5p

Accession MIMAT0021630
Sequence

9 -  

cugggaacaggcagggcacg

 - 28

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence gma-miR408b-3p

Accession MIMAT0021631
Sequence

106 -  

augcacugccucuucccuggc

 - 126

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).