Stem-loop sequence gma-MIR408c

AccessionMI0018649 (change log)
DescriptionGlycine max miR408c stem-loop
Gene family MIPF0000102; MIR408
Literature search

17 open access papers mention gma-MIR408c
(58 sentences)

Stem-loop 
           a      c      a     ga        u    acaauauugucaagaaagu 
5' gacaaagc ggggaa aggcag gcaug  uggagcua caac                   g
   |||||||| |||||| |||||| |||||  |||||||| ||||                   a
3' cuguuucg ucccuu uccguc cguac  gucuuggu guug                   g
           g      c      a     uc        -    ucuaaagaggagagugaaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 37083961-37084086 [-]
intergenic
Database links

Mature sequence gma-miR408c-5p

Accession MIMAT0022993
Sequence

8 -  

caggggaacaggcagagcaug

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR408c-3p

Accession MIMAT0021632
Previous IDsgma-miR408c
Sequence

100 -  

augcacugccucuucccuggc

 - 120

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).