![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR408c |
|||||
Accession | MI0018649 (change log) | ||||
Description | Glycine max miR408c stem-loop | ||||
Gene family | MIPF0000102; MIR408 | ||||
Literature search |
![]()
17 open access papers mention gma-MIR408c | ||||
Stem-loop |
a c a ga u acaauauugucaagaaagu 5' gacaaagc ggggaa aggcag gcaug uggagcua caac g |||||||| |||||| |||||| ||||| |||||||| |||| a 3' cuguuucg ucccuu uccguc cguac gucuuggu guug g g c a uc - ucuaaagaggagagugaaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR408c-5p |
|
Accession | MIMAT0022993 |
Sequence |
8 - caggggaacaggcagagcaug - 28 |
Evidence | experimental; Illumina [2] |
Mature sequence gma-miR408c-3p |
|
Accession | MIMAT0021632 |
Previous IDs | gma-miR408c |
Sequence |
100 - augcacugccucuucccuggc - 120 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|