![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR169l |
|||||
Accession | MI0018664 (change log) | ||||
Description | Glycine max miR169l stem-loop | ||||
Gene family | MIPF0000037; MIR169_2 | ||||
Literature search |
![]()
23 open access papers mention gma-MIR169l | ||||
Stem-loop |
ugauu c ug g ugcauauauaugcauuagguacc 5' gag ug agccaagaa acuugcc gaa a ||| || ||||||||| ||||||| ||| 3' cuc ac ucgguuuuu ugaacgg cuu a uauuu a gu g uaauauguuauguugauauauac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR169l-5p |
|
Accession | MIMAT0021652 |
Previous IDs | gma-miR169l |
Sequence |
11 - cagccaagaaugacuugccgg - 31 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR169l-3p |
|
Accession | MIMAT0022994 |
Sequence |
84 - cgggcaaguuguuuuuggcuac - 105 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|