![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR319i |
|||||
Accession | MI0018674 (change log) | ||||
Description | Glycine max miR319i stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
17 open access papers mention gma-MIR319i | ||||
Stem-loop |
g u - c c gg uuc gg uugaa u u gc g ac acacagaauagugauu 5' aa agag gaaggagcuucc uucag cca gcau g g gga ggg ugc gaa aucu cug ucauucauac c || |||| |||||||||||| ||||| ||| |||| | | ||| ||| ||| ||| |||| ||| |||||||||| 3' uu ucuu cuuccucgaggg aaguc ggu cgug u c ucu ccc acg uuu uaga gac aguaagugug a g u g a u uu --- uu ----- u u -a g ga uuaauggaaucguuaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR319i |
|
Accession | MIMAT0021663 |
Sequence |
164 - uuggacugaaggggagcuccuuc - 186 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|