![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR396h |
|||||
Accession | MI0018679 (change log) | ||||
Description | Glycine max miR396h stem-loop | ||||
Gene family | MIPF0000047; MIR396 | ||||
Literature search |
![]()
25 open access papers mention gma-MIR396h | ||||
Stem-loop |
-- u c c u acuguguugugugagguuucuccaagugaagguuu 5' gaau gguc uuuu gugau uuccacagcu ucuuga a |||| |||| |||| ||||| |||||||||| |||||| 3' cuug cuag agag cacua aaggugucga agaacu a cu u u a u uaacacgaguuucuuaaauacaacguauucccuag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR396h |
|
Accession | MIMAT0021668 |
Sequence |
22 - uccacagcuuucuugaacug - 41 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|