miRBase entry: hsa-mir-3670-2

Stem-loop hsa-mir-3670-2


Accession
MI0019112
Symbol
HGNC: MIR3670-2
Description
Homo sapiens hsa-mir-3670-2 precursor miRNA


Sequence

2 reads, 1 reads per million, 1 experiments
ucuagacugguauagcugcuuuuggagccucaccugcugAGAGCUCACAGCUGUCCUUCUCUAga
((((((..((.(((((((......((((((((.....)))).)))).)))))))))...))))))

Structure
      -cu  u       cuuuug    -    c 
ucuaga   gg auagcug      gagc cuca c
||||||   || |||||||      |||| |||| u
agAUCU   CC UGUCGAC      CUCG GAgu g
      CUU  -       -----A    A    c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr16: 16306370-16306434 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-3670-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-3670

Accession MIMAT0018093
Description Homo sapiens hsa-miR-3670 mature miRNA
Sequence 40 - AGAGCUCACAGCUGUCCUUCUCUA - 63
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20459673
    Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood
    Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A
    BMC Genomics (2010) 11:288