Stem-loop sequence sly-MIR391

AccessionMI0019258 (change log)
DescriptionSolanum lycopersicum miR391 stem-loop
Gene family MIPF0001809; MIR4376
Literature search

1 open access papers mention sly-MIR391
(4 sentences)

Stem-loop
   a       c  c       ag          a       ga      
5'  aggcuug ua gcaggag  augaugcugg cgauaga  aaaug 
    ||||||| || |||||||  |||||||||| |||||||  |||| g
3'  uccgaau au cguccuc  uacuacgacc guuauuu  uuuag 
   -       u  a       -a          g       aa      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 4541880-4541970 [+]
intergenic
Database links

Mature sequence sly-miR391

Accession MIMAT0022688
Sequence

11 - 

acgcaggagagaugaugcugga

 - 32

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:18078843 "Small RNAs in tomato fruit and leaf development" Itaya A, Bundschuh R, Archual AJ, Joung JG, Fei Z, Dai X, Zhao PX, Tang Y, Nelson RS, Ding B Biochim Biophys Acta. 1779:99-107(2008).
2
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
3
PMID:21917547 "Function and evolution of a MicroRNA that regulates a Ca2+-ATPase and triggers the formation of phased small interfering RNAs in tomato reproductive growth" Wang Y, Itaya A, Zhong X, Wu Y, Zhang J, van der Knaap E, Olmstead R, Qi Y, Ding B Plant Cell. 23:3185-3203(2011).