Stem-loop sequence gma-MIR5667

AccessionMI0019261 (change log)
DescriptionGlycine max miR5667 stem-loop
Literature search

1 open access papers mention gma-MIR5667
(1 sentences)

Stem-loop 
   g ug    a            c            ---c   a  a 
5'  u  gaac gaggaauccauu agaucuguuucg    aac cc u
    |  |||| |||||||||||| ||||||||||||    ||| || a
3'  a  cuug uuccuuagguaa ucuagacaaagu    uug gg u
   - gu    a            a            cagc   -  u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 5379134-5379221 [-]
intergenic
Database links

Mature sequence gma-miR5667-5p

Accession MIMAT0032130
Sequence

14 -  

aauccauucagaucuguuucg

 - 34

Get sequence
Evidence experimental; Illumina [3]

Mature sequence gma-miR5667-3p

Accession MIMAT0022449
Previous IDsgma-miR5667
Sequence

58 -  

aaacagaucuaaauggauucc

 - 78

Get sequence
Evidence experimental; Illumina [1-2], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).