Stem-loop sequence gma-MIR4401b

AccessionMI0019273 (change log)
DescriptionGlycine max miR4401b stem-loop
Gene family MIPF0001308; MIR4356
Stem-loop
   -       c           u        u            a -uaag u 
5'  ugagcaa uuucaaagacg ugcugagg aagcaccgucuu g     c g
    ||||||| ||||||||||| |||||||| |||||||||||| |     |  
3'  acucguu aaaguuucugc acgacucc uuugugguagaa c     g c
   c       u           c        u            a uuaca u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 14391631-14391732 [+]
intergenic
Database links

Mature sequence gma-miR4401b

Accession MIMAT0022461
Sequence

11 - 

ucaaagacguugcugagguaa

 - 31

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).